Stem-loop sequence ata-MIR166c

AccessionMI0031727 (change log)
DescriptionAegilops tauschii miR166c stem-loop
Gene family MIPF0000004; MIR166
Literature search

1 open access papers mention ata-MIR166c
(1 sentences)

Stem-loop
   --       ug     c uu g    cu   g  ----    u      
5'   cgguuug  gggaa g  g cugg  cga gc    aucc ugccg 
     |||||||  ||||| |  | ||||  ||| ||    |||| |||| a
3'   gccaaac  uccuu c  c gacc  gcu cg    uggg gcggc 
   cc       uu     a uu g    ag   g  gagc    c      
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (ASM34733v2; GCA_000347335.2) Overlapping transcripts
chr6: 322577448-322577538 [+]
intergenic
Database links

Mature sequence ata-miR166c-5p

Accession MIMAT0037248
Sequence

11 - 

ggaacguuggcuggcucgagg

 - 31

Get sequence
Evidence experimental; Illumina [1]

Mature sequence ata-miR166c-3p

Accession MIMAT0037249
Sequence

61 - 

ucggaccaggcuucauuccuu

 - 81

Get sequence
Evidence experimental; Illumina [1]

References

1
PMID:23535592 "Aegilops tauschii draft genome sequence reveals a gene repertoire for wheat adaptation" Jia J, Zhao S, Kong X, Li Y, Zhao G, He W, Appels R, Pfeifer M, Tao Y, Zhang X, Jing R, Zhang C, Ma Y, Gao L, Gao C, Spannagl M, Mayer KF, Li D, Pan S, Zheng F, Hu Q, Xia X, Li J, Liang Q, Chen J, Wicker T, Gou C, Kuang H, He G, Luo Y, Keller B, Xia Q, Lu Nature. 496:91-95(2013).