Stem-loop sequence ata-MIR399a

AccessionMI0031723 (change log)
DescriptionAegilops tauschii miR399a stem-loop
Gene family MIPF0000015; MIR399
Stem-loop
   gu       c       c      a        -        cau  aug    c    g    gaagaa  u 
5'   gugaauc cagggcg uucucc uuggcacg gcggcaug   gc   uagc aggu aguu      gc c
     ||||||| ||||||| |||||| |||||||| ||||||||   ||   |||| |||| ||||      || c
3'   cacuuag gucccgu aagagg aaccgugc ugucguac   cg   aucg ucca ucga      cg a
   uc       c       u      a        g        ---  ---    a    -    -aggca  u 
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (ASM34733v2; GCA_000347335.2) Overlapping transcripts
chr1: 436160654-436160793 [-]
intergenic
Database links

Mature sequence ata-miR399a-5p

Accession MIMAT0037240
Sequence

13 - 

gggcgcuucuccauuggcacgg

 - 34

Get sequence
Evidence experimental; Illumina [1]

Mature sequence ata-miR399a-3p

Accession MIMAT0037241
Sequence

110 - 

ugccaaaggagaauugcccug

 - 130

Get sequence
Evidence experimental; Illumina [1]

References

1
PMID:23535592 "Aegilops tauschii draft genome sequence reveals a gene repertoire for wheat adaptation" Jia J, Zhao S, Kong X, Li Y, Zhao G, He W, Appels R, Pfeifer M, Tao Y, Zhang X, Jing R, Zhang C, Ma Y, Gao L, Gao C, Spannagl M, Mayer KF, Li D, Pan S, Zheng F, Hu Q, Xia X, Li J, Liang Q, Chen J, Wicker T, Gou C, Kuang H, He G, Luo Y, Keller B, Xia Q, Lu Nature. 496:91-95(2013).