Stem-loop sequence ata-MIR9674a

AccessionMI0031705
DescriptionAegilops tauschii miR9674a stem-loop
Gene family MIPF0001917; MIR9674
Stem-loop
   -   c               u     c     uuca  g    uugc 
5'  gaa uuguccauagcauca ccauc uaccc    ac gugg    u
    ||| ||||||||||||||| ||||| |||||    || ||||    g
3'  cuu aauagguaucguagu gguag auggg    ug cacc    a
   a   c               c     a     ----  g    ccuu 
Get sequence
Confidence
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (ASM34733v1) Overlapping transcripts
KD508994.1: 4292-4383 [-]
intergenic

Mature sequence ata-miR9674a-5p

Accession MIMAT0037204
Sequence

11 - 

auagcaucauccauccuaccc

 - 31

Get sequence
Evidence experimental; Illumina [1]

Mature sequence ata-miR9674a-3p

Accession MIMAT0037205
Sequence

63 - 

guaagauggcugaugcuaugg

 - 83

Get sequence
Evidence experimental; Illumina [1]

References

1
PMID:23535592 "Aegilops tauschii draft genome sequence reveals a gene repertoire for wheat adaptation" Jia J, Zhao S, Kong X, Li Y, Zhao G, He W, Appels R, Pfeifer M, Tao Y, Zhang X, Jing R, Zhang C, Ma Y, Gao L, Gao C, Spannagl M, Mayer KF, Li D, Pan S, Zheng F, Hu Q, Xia X, Li J, Liang Q, Chen J, Wicker T, Gou C, Kuang H, He G, Luo Y, Keller B, Xia Q, Lu Nature. 496:91-95(2013).