Stem-loop sequence ata-MIR399b

AccessionMI0031702 (change log)
DescriptionAegilops tauschii miR399b stem-loop
Gene family MIPF0000015; MIR399
Stem-loop
   gu       c       c               gaggcauacuuguacugaugguaggaguuggccaggugagga 
5'   gugaauc cagggcg uucuccuuuggcacg                                          a
     ||||||| ||||||| |||||||||||||||                                           
3'   cacuuag gucccgu aagaggaaaccgugc                                          g
   uc       c       u               gcgcugcgccgaccgaucgacgugugugacuagccggaccuc 
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (ASM34733v2; GCA_000347335.2) Overlapping transcripts
chr4: 296544441-296544592 [+]
intergenic
Database links

Mature sequence ata-miR399b-5p

Accession MIMAT0037198
Sequence

11 - 

cagggcgcuucuccuuuggca

 - 31

Get sequence
Evidence experimental; Illumina [1]

Mature sequence ata-miR399b-3p

Accession MIMAT0037199
Sequence

122 - 

ugccaaaggagaauugcccug

 - 142

Get sequence
Evidence experimental; Illumina [1]

References

1
PMID:23535592 "Aegilops tauschii draft genome sequence reveals a gene repertoire for wheat adaptation" Jia J, Zhao S, Kong X, Li Y, Zhao G, He W, Appels R, Pfeifer M, Tao Y, Zhang X, Jing R, Zhang C, Ma Y, Gao L, Gao C, Spannagl M, Mayer KF, Li D, Pan S, Zheng F, Hu Q, Xia X, Li J, Liang Q, Chen J, Wicker T, Gou C, Kuang H, He G, Luo Y, Keller B, Xia Q, Lu Nature. 496:91-95(2013).