Stem-loop sequence ata-MIR9674c

AccessionMI0031700 (change log)
DescriptionAegilops tauschii miR9674c stem-loop
Stem-loop
   au  -             u              a  ggccauucaacucuggu 
5'   cc ucugguugaauuu uccauagcaucagc cc                 g
     || ||||||||||||| |||||||||||||| ||                 g
3'   gg aggccaacuuaaa agguaucguggucg gg                 u
   uu  u             u              c  uuuuccgucguugauga 
Get sequence
Confidence
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (ASM34733v2; GCA_000347335.2) Overlapping transcripts
chr4: 408976178-408976285 [-]
intergenic
Database links

Mature sequence ata-miR9674c-5p

Accession MIMAT0037194
Sequence

11 - 

ugaauuuuuccauagcaucag

 - 31

Get sequence
Evidence experimental; Illumina [1]

Mature sequence ata-miR9674c-3p

Accession MIMAT0037195
Sequence

79 - 

ggugcuauggauaaauucaac

 - 99

Get sequence
Evidence experimental; Illumina [1]

References

1
PMID:23535592 "Aegilops tauschii draft genome sequence reveals a gene repertoire for wheat adaptation" Jia J, Zhao S, Kong X, Li Y, Zhao G, He W, Appels R, Pfeifer M, Tao Y, Zhang X, Jing R, Zhang C, Ma Y, Gao L, Gao C, Spannagl M, Mayer KF, Li D, Pan S, Zheng F, Hu Q, Xia X, Li J, Liang Q, Chen J, Wicker T, Gou C, Kuang H, He G, Luo Y, Keller B, Xia Q, Lu Nature. 496:91-95(2013).