Stem-loop sequence ata-MIR396b

AccessionMI0031694 (change log)
DescriptionAegilops tauschii miR396b stem-loop
Gene family MIPF0000047; MIR396
Literature search

1 open access papers mention ata-MIR396b
(1 sentences)

Stem-loop
   --  c    cuc    ca                    -uc   c  gccggccauccauggccuuccuuugcugccgaauucgcau 
5'   gg caug   ucca  ggcuuucuugaacugucaac   gcg gc                                        a
     || ||||   ||||  ||||||||||||||||||||   ||| ||                                        u
3'   cc guac   aggu  cugaaagaacuugguaguug   cgu cg                                        g
   cg  c    aaa    uc                    uuc   c  ucucuagguagccuagcgugcucuagcucuguacguucuc 
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Database links

Mature sequence ata-miR396b-5p

Accession MIMAT0037182
Sequence

11 - 

uccacaggcuuucuugaacug

 - 31

Get sequence
Evidence experimental; Illumina [1]

Mature sequence ata-miR396b-3p

Accession MIMAT0037183
Sequence

144 - 

guucaagaaaguccuuggaa

 - 163

Get sequence
Evidence experimental; Illumina [1]

References

1
PMID:23535592 "Aegilops tauschii draft genome sequence reveals a gene repertoire for wheat adaptation" Jia J, Zhao S, Kong X, Li Y, Zhao G, He W, Appels R, Pfeifer M, Tao Y, Zhang X, Jing R, Zhang C, Ma Y, Gao L, Gao C, Spannagl M, Mayer KF, Li D, Pan S, Zheng F, Hu Q, Xia X, Li J, Liang Q, Chen J, Wicker T, Gou C, Kuang H, He G, Luo Y, Keller B, Xia Q, Lu Nature. 496:91-95(2013).