Stem-loop sequence ata-MIR396e

AccessionMI0031687 (change log)
DescriptionAegilops tauschii miR396e stem-loop
Gene family MIPF0000047; MIR396
Literature search

1 open access papers mention ata-MIR396e
(1 sentences)

Stem-loop
   --      u  c            c          ucugcaauugguggaugc 
5'   cuuugc gu uuccacagcuuu uugaacugca                  u
     |||||| || |||||||||||| ||||||||||                   
3'   gagacg ua agggugucgaaa aacuugacgu                  a
   ga      u  a            u          cuagaacgcucgucuucg 
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (ASM34733v2; GCA_000347335.2) Overlapping transcripts
chr7: 76829699-76829804 [+]
intergenic
Database links

Mature sequence ata-miR396e-5p

Accession MIMAT0037168
Sequence

11 - 

uuccacagcuuucuugaacug

 - 31

Get sequence
Evidence experimental; Illumina [1]

Mature sequence ata-miR396e-3p

Accession MIMAT0037169
Sequence

76 - 

guucaauaaagcugugggaaa

 - 96

Get sequence
Evidence experimental; Illumina [1]

References

1
PMID:23535592 "Aegilops tauschii draft genome sequence reveals a gene repertoire for wheat adaptation" Jia J, Zhao S, Kong X, Li Y, Zhao G, He W, Appels R, Pfeifer M, Tao Y, Zhang X, Jing R, Zhang C, Ma Y, Gao L, Gao C, Spannagl M, Mayer KF, Li D, Pan S, Zheng F, Hu Q, Xia X, Li J, Liang Q, Chen J, Wicker T, Gou C, Kuang H, He G, Luo Y, Keller B, Xia Q, Lu Nature. 496:91-95(2013).