Stem-loop sequence ata-MIR9772b

AccessionMI0031680
DescriptionAegilops tauschii miR9772b stem-loop
Gene family MIPF0001934; MIR9772
Stem-loop
   u  c   c      a       a    a   cauaua    c  c 
5'  ag ggc guugag ugagauu cccc uac      gcgg ag u
    || ||| |||||| ||||||| |||| |||      |||| || c
3'  uc ucg caacuc acucuaa gggg aug      cgcc uc g
   c  u   a      c       c    g   cgcaca    -  a 
Get sequence
Confidence
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (ASM34733v1) Overlapping transcripts
KD526771.1: 25352-25443 [-]
intergenic

Mature sequence ata-miR9772b-5p

Accession MIMAT0037154
Sequence

11 - 

ugagaugagauuaccccauac

 - 31

Get sequence
Evidence experimental; Illumina [1]

Mature sequence ata-miR9772b-3p

Accession MIMAT0037155
Sequence

64 - 

agggggcaaucucaccucaac

 - 84

Get sequence
Evidence experimental; Illumina [1]

References

1
PMID:23535592 "Aegilops tauschii draft genome sequence reveals a gene repertoire for wheat adaptation" Jia J, Zhao S, Kong X, Li Y, Zhao G, He W, Appels R, Pfeifer M, Tao Y, Zhang X, Jing R, Zhang C, Ma Y, Gao L, Gao C, Spannagl M, Mayer KF, Li D, Pan S, Zheng F, Hu Q, Xia X, Li J, Liang Q, Chen J, Wicker T, Gou C, Kuang H, He G, Luo Y, Keller B, Xia Q, Lu Nature. 496:91-95(2013).