Stem-loop sequence ata-MIR9772a

AccessionMI0031655
DescriptionAegilops tauschii miR9772a stem-loop
Gene family MIPF0001934; MIR9772
Stem-loop
   c      c      a       a    a   - c    g   c  c 
5'  agcggc guugag ugagauu cccc uac c ugua cgg ag u
    |||||| |||||| ||||||| |||| ||| | |||| ||| || c
3'  ucgucg caacuc acucuaa gggg aug g acgu gcc uc g
   c      a      c       c    g   c c    -   -  a 
Get sequence
Confidence
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (ASM34733v1) Overlapping transcripts
KD548958.1: 64076-64167 [-]
intergenic

Mature sequence ata-miR9772a-5p

Accession MIMAT0037106
Sequence

11 - 

ugagaugagauuaccccauac

 - 31

Get sequence
Evidence experimental; Illumina [1]

Mature sequence ata-miR9772a-3p

Accession MIMAT0037107
Sequence

64 - 

agggggcaaucucaccucaac

 - 84

Get sequence
Evidence experimental; Illumina [1]

References

1
PMID:23535592 "Aegilops tauschii draft genome sequence reveals a gene repertoire for wheat adaptation" Jia J, Zhao S, Kong X, Li Y, Zhao G, He W, Appels R, Pfeifer M, Tao Y, Zhang X, Jing R, Zhang C, Ma Y, Gao L, Gao C, Spannagl M, Mayer KF, Li D, Pan S, Zheng F, Hu Q, Xia X, Li J, Liang Q, Chen J, Wicker T, Gou C, Kuang H, He G, Luo Y, Keller B, Xia Q, Lu Nature. 496:91-95(2013).