Stem-loop sequence ssc-mir-96

AccessionMI0031644 (change log)
DescriptionSus scrofa miR-96 stem-loop
Gene family MIPF0000072; mir-96
Literature search

4 open access papers mention ssc-mir-96
(5 sentences)

Stem-loop
   -   --gg  g  u        a      uu      ---   uc 
5'  cug    cc au uuggcacu gcacau  uugcuu   gug  u
    |||    || || |||||||| ||||||  ||||||   |||   
3'  gac    gg ua aaccguga cgugua  aacgag   cgc  c
   g   gaaa  g  u        -      uu      ucu   cu 
Get sequence
Deep sequencing
2430 reads, 527 reads per million, 15 experiments
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (Sscrofa10.2; GCA_000003025.4) Overlapping transcripts
chr18: 20030888-20030972 [+]
sense
Clustered miRNAs
< 10kb from ssc-mir-96
ssc-mir-183chr18: 20030651-20030720 [+]
ssc-mir-96chr18: 20030888-20030972 [+]
ssc-mir-182chr18: 20035212-20035295 [+]
Database links

Mature sequence ssc-miR-96-5p

Accession MIMAT0037085
Sequence

11 - 

uuuggcacuagcacauuuuugcu

 - 33

Get sequence
Deep sequencing2428 reads, 15 experiments
Evidence experimental; Illumina [1]

References

1
PMID:24499489 "Exploration of microRNAs in porcine milk exosomes" Chen T, Xi QY, Ye RS, Cheng X, Qi QE, Wang SB, Shu G, Wang LN, Zhu XT, Jiang QY, Zhang YL BMC Genomics. 15:100(2014).