Stem-loop sequence ssc-mir-9862

AccessionMI0031643 (change log)
DescriptionSus scrofa miR-9862 stem-loop
Stem-loop
   g       -u     ug  gu   aug     c   aa   u  a   gc 
5'  cucacca  cucuu  ua  cug   uaaau aug  uga gc cca  c
    |||||||  |||||  ||  |||   ||||| |||  ||| || |||  u
3'  ggguggu  gaggg  gu  gau   auuua uac  acu ug ggu  a
   -       cu     uu  ug   --a     -   ag   -  g   ag 
Get sequence
Deep sequencing
3 reads, 0 reads per million, 2 experiments
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (Sscrofa10.2; GCA_000003025.4) Overlapping transcripts
chr15: 155563758-155563854 [+]
intergenic
Database links

Mature sequence ssc-miR-9862-3p

Accession MIMAT0037084
Sequence

68 - 

uauuuaauagguuguuggga

 - 87

Get sequence
Deep sequencing1 reads, 1 experiments
Evidence experimental; Illumina [1]

References

1
PMID:24499489 "Exploration of microRNAs in porcine milk exosomes" Chen T, Xi QY, Ye RS, Cheng X, Qi QE, Wang SB, Shu G, Wang LN, Zhu XT, Jiang QY, Zhang YL BMC Genomics. 15:100(2014).