Stem-loop sequence ssc-mir-219b

AccessionMI0031642 (change log)
DescriptionSus scrofa miR-219b stem-loop
Gene family MIPF0000044; mir-219
Literature search

3 open access papers mention ssc-mir-219b
(5 sentences)

Stem-loop
   g    c     u   u     aa           uac a  c 
5'  gcuu gccac gau gucca  cgcaauucuug   g gu u
    |||| ||||| ||| |||||  |||||||||||   | || g
3'  cgag cggug cua caggu  guguuaagagc   c cg c
   -    u     u   -     cg           caa -  g 
Get sequence
Deep sequencing
36 reads, 0 reads per million, 9 experiments
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (Sscrofa10.2; GCA_000003025.4) Overlapping transcripts
chr1: 302806853-302806936 [-]
sense
Database links

Mature sequence ssc-miR-219b-3p

Accession MIMAT0037083
Sequence

55 - 

agaauuguggcuggacaucu

 - 74

Get sequence
Deep sequencing1 reads, 1 experiments
Evidence experimental; Illumina [1]

References

1
PMID:24499489 "Exploration of microRNAs in porcine milk exosomes" Chen T, Xi QY, Ye RS, Cheng X, Qi QE, Wang SB, Shu G, Wang LN, Zhu XT, Jiang QY, Zhang YL BMC Genomics. 15:100(2014).