Stem-loop sequence ssc-mir-378b

AccessionMI0031641 (change log)
DescriptionSus scrofa miR-378b stem-loop
Literature search

20 open access papers mention ssc-mir-378b
(97 sentences)

Stem-loop
   uu     a  uuu    g guu        g cug  - g 
5'   gagcu ca   gcuu c   cucuaagu u   gc u a
     ||||| ||   |||| |   |||||||| |   || |  
3'   cuugg gu   ugaa g   gagguuca g   cg a a
   uc     a  ---    - acu        g uca  c a 
Get sequence
Deep sequencing
275 reads, 0 reads per million, 14 experiments
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (Sscrofa10.2; GCA_000003025.4) Overlapping transcripts
chr1: 284932187-284932263 [-]
antisense
Database links

Mature sequence ssc-miR-378b-3p

Accession MIMAT0037082
Sequence

47 - 

acuggacuuggagucagaagu

 - 67

Get sequence
Deep sequencing275 reads, 14 experiments
Evidence experimental; Illumina [1]

References

1
PMID:24499489 "Exploration of microRNAs in porcine milk exosomes" Chen T, Xi QY, Ye RS, Cheng X, Qi QE, Wang SB, Shu G, Wang LN, Zhu XT, Jiang QY, Zhang YL BMC Genomics. 15:100(2014).