Stem-loop sequence ssc-mir-371

AccessionMI0031640 (change log)
DescriptionSus scrofa miR-371 stem-loop
Gene family MIPF0000068; mir-290
Literature search

2 open access papers mention ssc-mir-371
(7 sentences)

Stem-loop
   agc u  gg        cu    g          gg c 
5'    c gu  uacucaaa  gugg ggcacuuucu  u u
      | ||  ||||||||  |||| ||||||||||  |  
3'    g ca  gugaguuu  uacc ccgugaaggg  g a
   uua c  uu        uu    g          ag g 
Get sequence
Deep sequencing
2 reads, 0 reads per million, 2 experiments
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (Sscrofa10.2; GCA_000003025.4) Overlapping transcripts
chr6: 52738857-52738934 [+]
sense
Database links

Mature sequence ssc-miR-371-5p

Accession MIMAT0037081
Sequence

11 - 

acucaaacugugggggcacuuu

 - 32

Get sequence
Deep sequencing1 reads, 1 experiments
Evidence experimental; Illumina [1]

References

1
PMID:24499489 "Exploration of microRNAs in porcine milk exosomes" Chen T, Xi QY, Ye RS, Cheng X, Qi QE, Wang SB, Shu G, Wang LN, Zhu XT, Jiang QY, Zhang YL BMC Genomics. 15:100(2014).