Stem-loop sequence ssc-mir-9844

AccessionMI0031613 (change log)
DescriptionSus scrofa miR-9844 stem-loop
Stem-loop
   u     ag gug    -     aau    -u      -uaagug  aa 
5'  cugaa  u   ugau ucuaa   ucag  guuccc       ca  g
    |||||  |   |||| |||||   ||||  ||||||       ||   
3'  gacuu  g   auug agguu   aguu  uaaggg       gu  c
   g     aa --a    u     guc    uc      ucuaaaa  cu 
Get sequence
Deep sequencing
4 reads, 0 reads per million, 3 experiments
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (Sscrofa10.2; GCA_000003025.4) Overlapping transcripts
chr15: 155314801-155314893 [+]
sense
Database links

Mature sequence ssc-miR-9844-3p

Accession MIMAT0037062
Sequence

64 - 

ucuuugacuguuggauguua

 - 83

Get sequence
Evidence experimental; Illumina [1]

References

1
PMID:24499489 "Exploration of microRNAs in porcine milk exosomes" Chen T, Xi QY, Ye RS, Cheng X, Qi QE, Wang SB, Shu G, Wang LN, Zhu XT, Jiang QY, Zhang YL BMC Genomics. 15:100(2014).