Stem-loop sequence ssc-mir-9843

AccessionMI0031612 (change log)
DescriptionSus scrofa miR-9843 stem-loop
Literature search

1 open access papers mention ssc-mir-9843
(2 sentences)

Stem-loop
   u    a                c  c         au  a 
5'  acac gcuuuccagagguuuc ag uuauaggau  uc u
    |||| |||||||||||||||| || |||||||||  ||  
3'  ugug ugaaaggucuccaaag uc agugucuug  gg a
   -    g                a  a         au  u 
Get sequence
Deep sequencing
129 reads, 0 reads per million, 12 experiments
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (Sscrofa10.2; GCA_000003025.4) Overlapping transcripts
chr8: 122371904-122371984 [-]
sense
ENSSSCT00000010022 ; SGMS2-201; intron 1
Database links

Mature sequence ssc-miR-9843-3p

Accession MIMAT0037061
Sequence

50 - 

ucugugaacuagaaaccucugg

 - 71

Get sequence
Deep sequencing125 reads, 12 experiments
Evidence experimental; Illumina [1]

References

1
PMID:24499489 "Exploration of microRNAs in porcine milk exosomes" Chen T, Xi QY, Ye RS, Cheng X, Qi QE, Wang SB, Shu G, Wang LN, Zhu XT, Jiang QY, Zhang YL BMC Genomics. 15:100(2014).