Stem-loop sequence ssc-mir-9830

AccessionMI0031599 (change log)
DescriptionSus scrofa miR-9830 stem-loop
Stem-loop
   auacca     u --u g    -    g u    cac 
5'       cggug c   g aaag gucg a gagu   c
         ||||| |   | |||| |||| | ||||    
3'       gccac g   c uuuc cggc u cuca   c
   uccuga     u cgu g    u    g -    cga 
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (Sscrofa10.2; GCA_000003025.4) Overlapping transcripts
chr7: 128734437-128734508 [-]
intergenic
Database links

Mature sequence ssc-miR-9830-5p

Accession MIMAT0037048
Sequence

11 - 

gucuggaaaggucggaugagu

 - 31

Get sequence
Evidence experimental; Illumina [1]

References

1
PMID:24499489 "Exploration of microRNAs in porcine milk exosomes" Chen T, Xi QY, Ye RS, Cheng X, Qi QE, Wang SB, Shu G, Wang LN, Zhu XT, Jiang QY, Zhang YL BMC Genomics. 15:100(2014).