Stem-loop sequence ssc-mir-9806-2

AccessionMI0031571 (change log)
DescriptionSus scrofa miR-9806-2 stem-loop
Gene family MIPF0001914; mir-9806
Stem-loop
   u     cu     c   -  g -a     -gac   c 
5'  gcuuu  uuccu gcu ga u  gucug    cca g
    |||||  ||||| ||| || |  |||||    |||  
3'  cggag  gagga cgg cu g  uagac    ggu u
   c     cc     c   u  g ca     ggac   g 
Get sequence
Deep sequencing
1 reads, 0 reads per million, 1 experiments
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (Sscrofa10.2; GCA_000003025.4) Overlapping transcripts
chr9: 101337074-101337146 [-]
intergenic
Clustered miRNAs
< 10kb from ssc-mir-9806-2
ssc-mir-9806-4chr9: 101343243-101343315 [-]
ssc-mir-9806-3chr9: 101340155-101340227 [-]
ssc-mir-9806-2chr9: 101337074-101337146 [-]
Database links

Mature sequence ssc-miR-9806-5p

Accession MIMAT0037024
Sequence

11 - 

ccucgcugaguagucuggacc

 - 31

Get sequence
Deep sequencing4 reads, 1 experiments
Evidence experimental; Illumina [1]

References

1
PMID:24499489 "Exploration of microRNAs in porcine milk exosomes" Chen T, Xi QY, Ye RS, Cheng X, Qi QE, Wang SB, Shu G, Wang LN, Zhu XT, Jiang QY, Zhang YL BMC Genomics. 15:100(2014).