Stem-loop sequence ssc-mir-9795

AccessionMI0031559 (change log)
DescriptionSus scrofa miR-9795 stem-loop
Stem-loop
   aa  u     u  -     agg  a   -c       aga   c 
5'   gc caggc gc ugucu   cc cug  uuuggaa   ggc c
     || ||||| || |||||   || |||  |||||||   |||  
3'   cg guccg cg gcagg   gg gau  agaccuu   ucg a
   ga  -     c  u     --a  -   uu       gga   c 
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (Sscrofa10.2; GCA_000003025.4) Overlapping transcripts
chr4: 8240996-8241079 [-]
sense
ENSSSCT00000006531 ; TG-201; intron 48
chrUScaf3747: 76560-76643 [-]
sense
ENSSSCT00000006531 ; TG-201; intron 48
Database links

Mature sequence ssc-miR-9795-3p

Accession MIMAT0037013
Sequence

55 - 

cagauuuagggaggacgugc

 - 74

Get sequence
Evidence experimental; Illumina [1]

References

1
PMID:24499489 "Exploration of microRNAs in porcine milk exosomes" Chen T, Xi QY, Ye RS, Cheng X, Qi QE, Wang SB, Shu G, Wang LN, Zhu XT, Jiang QY, Zhang YL BMC Genomics. 15:100(2014).