Stem-loop sequence tae-MIR9778

AccessionMI0031533
DescriptionTriticum aestivum miR9778 stem-loop
Stem-loop
       c        a   c        c    --c         - a 
5' gaag ccugcauc ucu gaacucgu ggug   gauagcgug c g
   |||| |||||||| ||| |||||||| ||||   ||||||||| | c
3' cuuc ggacguag aga cuugagca ccac   uugucguac g g
       c        c   c        a    uac         a u 
Get sequence
Deep sequencing
70 reads, 82.6 reads per million, 1 experiments
Confidence
Feedback: Do you believe this miRNA is real?
Comments

This sequence was incorrectly named MIR2015 in [1].

Mature sequence tae-miR9778

Accession MIMAT0036991
Sequence

8 - 

ugcaucaucucgaacucgucg

 - 28

Get sequence
Deep sequencing53 reads, 1 experiments
Evidence experimental; Illumina [1]

References

1
PMID:19499258 "Novel microRNAs uncovered by deep sequencing of small RNA transcriptomes in bread wheat (Triticum aestivum L.) and Brachypodium distachyon (L.) Beauv" Wei B, Cai T, Zhang R, Li A, Huo N, Li S, Gu YQ, Vogel J, Jia J, Qi Y, Mao L Funct Integr Genomics. 9:499-511(2009).