Stem-loop sequence tae-MIR9772

AccessionMI0031524 (change log)
DescriptionTriticum aestivum miR9772 stem-loop
Gene family MIPF0001934; MIR9772
Stem-loop
     c   c      a       a    a   cauaua    c  c 
5' ag ggc guugag ugagauu cccc uac      gcgg ag u
   || ||| |||||| ||||||| |||| |||      |||| || c
3' uc ucg caacuc acucuaa gggg aug      cgcc uc g
     u   a      c       c    g   cgcaca    -  a 
Get sequence
Confidence Annotation confidence: high
Feedback: Do you believe this miRNA is real?
Comments

This sequence was incorrectly named MIR2002 in [1].

Genome context
Coordinates Overlapping transcripts
5D: 148334018-148334107 [-]
intergenic
Database links

Mature sequence tae-miR9772

Accession MIMAT0036982
Sequence

10 - 

ugagaugagauuaccccauac

 - 30

Get sequence
Evidence experimental; Illumina [1]

References

1
PMID:19499258 "Novel microRNAs uncovered by deep sequencing of small RNA transcriptomes in bread wheat (Triticum aestivum L.) and Brachypodium distachyon (L.) Beauv" Wei B, Cai T, Zhang R, Li A, Huo N, Li S, Gu YQ, Vogel J, Jia J, Qi Y, Mao L Funct Integr Genomics. 9:499-511(2009).