Stem-loop sequence hsa-mir-3179-4

AccessionMI0031510 (change log)
Symbol HGNC:MIR3179-4
DescriptionHomo sapiens miR-3179-4 stem-loop
Gene family MIPF0000900; mir-3179
Literature search

3 open access papers mention hsa-mir-3179-4
(5 sentences)

Stem-loop
                         a               gcc 
5' caggaucacagacguuuaaauu cacuccuucugcugu   u
   |||||||||||||||||||||| |||||||||||||||    
3' guccuagugucugcaaauuuaa guggggaagaugacg   u
                         a               aca 
Get sequence
Deep sequencing
691 reads, 0 reads per million, 71 experiments
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (GRCh38; GCA_000001405.15) Overlapping transcripts
chr16: 18494493-18494576 [-]
sense
OTTHUMT00000388923 ; PKD1P5-001; intron 1
OTTHUMT00000400310 ; PKD1P5-002; intron 1
ENST00000532415 ; PKD1P5-001; intron 1
ENST00000544578 ; PKD1P5-002; intron 1
Clustered miRNAs
< 10kb from hsa-mir-3179-4
hsa-mir-3179-4chr16: 18494493-18494576 [-]
hsa-mir-3670-4chr16: 18488301-18488365 [-]
Database links

Mature sequence hsa-miR-3179

Accession MIMAT0015056
Sequence

52 - 

agaaggggugaaauuuaaacgu

 - 73

Get sequence
Deep sequencing2540 reads, 62 experiments
Evidence experimental; Illumina [1-2]

References

1
PMID:20300190 "Characterization of the Melanoma miRNAome by Deep Sequencing" Stark MS, Tyagi S, Nancarrow DJ, Boyle GM, Cook AL, Whiteman DC, Parsons PG, Schmidt C, Sturm RA, Hayward NK PLoS One. 5:e9685(2010).
2
PMID:21199797 "Identification of new microRNAs in paired normal and tumor breast tissue suggests a dual role for the ERBB2/Her2 gene" Persson H, Kvist A, Rego N, Staaf J, Vallon-Christersson J, Luts L, Loman N, Jonsson G, Naya H, Hoglund M, Borg A, Rovira C Cancer Res. 71:78-86(2011).