Stem-loop sequence bta-mir-3432b

AccessionMI0031505 (change log)
DescriptionBos taurus miR-3432b stem-loop
Gene family MIPF0001187; mir-3432
Literature search

3 open access papers mention bta-mir-3432b
(4 sentences)

Stem-loop
   -c           uugc    uuc    ucu    u g gg     --g   u 
5'   uuugaucuuug    ggca   ggga   uuag u u  uaugc   aac c
     |||||||||||    ||||   ||||   |||| | |  |||||   ||| u
3'   aaacuagggac    cugu   cccu   gauc a g  guacg   uug u
   cc           ----    ---    --u    u g gu     acg   a 
Get sequence
Deep sequencing
4151 reads, 9.09 reads per million, 66 experiments
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (Btau_5.0.1; GCA_000003205.6) Overlapping transcripts
chr7: 19158248-19158344 [-]
intergenic
Database links

Mature sequence bta-miR-3432b

Accession MIMAT0036976
Sequence

21 - 

uucgggaucuuuaguuguggu

 - 41

Get sequence
Deep sequencing4142 reads, 66 experiments
Evidence experimental; Illumina [1]
Predicted targets

References

1
PMID:24021155 "Profiling microRNA expression in bovine alveolar macrophages using RNA-seq" Vegh P, Foroushani AB, Magee DA, McCabe MS, Browne JA, Nalpas NC, Conlon KM, Gordon SV, Bradley DG, MacHugh DE, Lynn DJ Vet Immunol Immunopathol. 155:238-244(2013).