Stem-loop sequence bta-mir-378d

AccessionMI0031501 (change log)
DescriptionBos taurus miR-378d stem-loop
Gene family MIPF0000168; mir-378
Literature search

24 open access papers mention bta-mir-378d
(100 sentences)

Stem-loop
   --u   cu      g      cag   uau    ---agggag   g u 
5'    ggg  uucugg uccagg   cag   gcuc         gca c a
      |||  |||||| ||||||   |||   ||||         ||| |  
3'    ucc  aagacu agguuc   guc   cgag         cgu g c
   gac   ag      g      -ag   --u    ggaaagaga   - g 
Get sequence
Deep sequencing
579905 reads, 4.5e+03 reads per million, 77 experiments
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (Btau_5.0.1; GCA_000003205.6) Overlapping transcripts
chr19: 8813899-8813989 [-]
antisense
ENSBTAT00000005780 ; MSI2-201; intron 4
Database links

Mature sequence bta-miR-378d

Accession MIMAT0036972
Sequence

66 - 

cuggacuuggagucagaagacc

 - 87

Get sequence
Deep sequencing579905 reads, 77 experiments
Evidence experimental; Illumina [1]
Predicted targets

References

1
PMID:24021155 "Profiling microRNA expression in bovine alveolar macrophages using RNA-seq" Vegh P, Foroushani AB, Magee DA, McCabe MS, Browne JA, Nalpas NC, Conlon KM, Gordon SV, Bradley DG, MacHugh DE, Lynn DJ Vet Immunol Immunopathol. 155:238-244(2013).