Stem-loop sequence bta-mir-1842

AccessionMI0031498 (change log)
DescriptionBos taurus miR-1842 stem-loop
Gene family MIPF0000788; mir-1842
Literature search

2 open access papers mention bta-mir-1842
(2 sentences)

Stem-loop
   --ug      ug     g      g  ggg 
5'     gcucug  agguc gcucaa gu   u
       ||||||  ||||| |||||| ||    
3'     cgggac  uccgg cgaguu ua   c
   guug      ug     a      g  ggu 
Get sequence
Deep sequencing
1365 reads, 1.52 reads per million, 66 experiments
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (Btau_5.0.1; GCA_000003205.6) Overlapping transcripts
chr25: 1755151-1755210 [-]
intergenic
Clustered miRNAs
< 10kb from bta-mir-1842
bta-mir-2382chr25: 1755398-1755474 [-]
bta-mir-1842chr25: 1755151-1755210 [-]
Database links

Mature sequence bta-miR-1842

Accession MIMAT0036969
Sequence

1 - 

uggcucugugaggucggcuca

 - 21

Get sequence
Deep sequencing1272 reads, 65 experiments
Evidence experimental; Illumina [1]
Predicted targets

References

1
PMID:24021155 "Profiling microRNA expression in bovine alveolar macrophages using RNA-seq" Vegh P, Foroushani AB, Magee DA, McCabe MS, Browne JA, Nalpas NC, Conlon KM, Gordon SV, Bradley DG, MacHugh DE, Lynn DJ Vet Immunol Immunopathol. 155:238-244(2013).