Stem-loop sequence oha-mir-9-2

AccessionMI0031488 (change log)
DescriptionOphiophagus hannah miR-9-2 stem-loop
Gene family MIPF0000014; mir-9
Stem-loop
   --g     u   -    c            u     agacc 
5'    gaguu uua cuuu gguuaucuagcu uauga     a
      ||||| ||| |||| |||||||||||| |||||      
3'    cucaa aau gaaa ccaauagaucga auacu     a
   uca     c   a    -            c     cacac 
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (OphHan1.0; GCA_000516915.1) Overlapping transcripts
AZIM01000360.1: 98944-99023 [-]
intergenic
Database links

Mature sequence oha-miR-9-2-5p

Accession MIMAT0036955
Sequence

13 - 

uucgguuaucuagcuuuaugaa

 - 34

Get sequence
Evidence not experimental

Mature sequence oha-miR-9-3p

Accession MIMAT0036954
Sequence

46 - 

ucauacagcuagauaaccaaaga

 - 68

Get sequence
Evidence not experimental

References

1
PMID:24297900 "The king cobra genome reveals dynamic gene evolution and adaptation in the snake venom system" Vonk FJ, Casewell NR, Henkel CV, Heimberg AM, Jansen HJ, McCleary RJ, Kerkkamp HM, Vos RA, Guerreiro I, Calvete JJ, Wuster W, Woods AE, Logan JM, Harrison RA, Castoe TA, de Koning AP, Pollock DD, Yandell M, Calderon D, Renjifo C, Currier RB, Salgado D, Pl Proc Natl Acad Sci U S A. 110:20651-20656(2013).