Stem-loop sequence oha-mir-456

AccessionMI0031474 (change log)
DescriptionOphiophagus hannah miR-456 stem-loop
Gene family MIPF0000341; mir-456
Stem-loop
   ugu        g   g     uc       acau ug    c 
5'    auguguga cag caucu  ucagccu    g  gauu u
      |||||||| ||| |||||  |||||||    |  ||||  
3'    uacauacu guu guaga  ggucgga    c  cuaa u
   ---        -   g     uu       ---- gu    a 
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (OphHan1.0; GCA_000516915.1) Overlapping transcripts
AZIM01004097.1: 14818-14895 [-]
intergenic
Database links

Mature sequence oha-miR-456

Accession MIMAT0036933
Sequence

52 - 

caggcugguuagaugguuguca

 - 73

Get sequence
Evidence not experimental

References

1
PMID:24297900 "The king cobra genome reveals dynamic gene evolution and adaptation in the snake venom system" Vonk FJ, Casewell NR, Henkel CV, Heimberg AM, Jansen HJ, McCleary RJ, Kerkkamp HM, Vos RA, Guerreiro I, Calvete JJ, Wuster W, Woods AE, Logan JM, Harrison RA, Castoe TA, de Koning AP, Pollock DD, Yandell M, Calderon D, Renjifo C, Currier RB, Salgado D, Pl Proc Natl Acad Sci U S A. 110:20651-20656(2013).