Stem-loop sequence oha-mir-455

AccessionMI0031473 (change log)
DescriptionOphiophagus hannah miR-455 stem-loop
Gene family MIPF0000129; mir-455
Stem-loop
   acu  uc   -  u ug  g          u      a   c    aa 
5'    gg  ccu gg g  ag guaugugccc uggacu cau gugg  a
      ||  ||| || |  || |||||||||| |||||| ||| ||||   
3'    cu  gga cc c  uc cauauacggg accuga gua cacu  a
   ---  uu   a  c gu  a          u      c   c    au 
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (OphHan1.0; GCA_000516915.1) Overlapping transcripts
AZIM01007366.1: 24031-24124 [+]
intergenic
Database links

Mature sequence oha-miR-455-5p

Accession MIMAT0036931
Sequence

21 - 

uaugugcccuuggacuacaucg

 - 42

Get sequence
Evidence not experimental

Mature sequence oha-miR-455-3p

Accession MIMAT0036932
Sequence

59 - 

gcaguccaugggcauauacac

 - 79

Get sequence
Evidence not experimental

References

1
PMID:24297900 "The king cobra genome reveals dynamic gene evolution and adaptation in the snake venom system" Vonk FJ, Casewell NR, Henkel CV, Heimberg AM, Jansen HJ, McCleary RJ, Kerkkamp HM, Vos RA, Guerreiro I, Calvete JJ, Wuster W, Woods AE, Logan JM, Harrison RA, Castoe TA, de Koning AP, Pollock DD, Yandell M, Calderon D, Renjifo C, Currier RB, Salgado D, Pl Proc Natl Acad Sci U S A. 110:20651-20656(2013).