Stem-loop sequence oha-mir-383

AccessionMI0031467 (change log)
DescriptionOphiophagus hannah miR-383 stem-loop
Gene family MIPF0000137; mir-383
Stem-loop
   acc     -c  a      aa    a        uug    ga 
5'    ugcuc  uc gaucag  ggug uuguggcu   guuu  u
      |||||  || ||||||  |||| ||||||||   ||||   
3'    acgag  ag cugguc  ucac gacaccga   caaa  a
   -ga     aa  a      cg    -        ---    gu 
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (OphHan1.0; GCA_000516915.1) Overlapping transcripts
AZIM01001937.1: 343504-343585 [+]
intergenic
Database links

Mature sequence oha-miR-383-5p

Accession MIMAT0036919
Sequence

12 - 

agaucagaaggugauuguggcu

 - 33

Get sequence
Evidence not experimental

Mature sequence oha-miR-383-3p

Accession MIMAT0036920
Sequence

53 - 

ccacagcacugccuggucaga

 - 73

Get sequence
Evidence not experimental

References

1
PMID:24297900 "The king cobra genome reveals dynamic gene evolution and adaptation in the snake venom system" Vonk FJ, Casewell NR, Henkel CV, Heimberg AM, Jansen HJ, McCleary RJ, Kerkkamp HM, Vos RA, Guerreiro I, Calvete JJ, Wuster W, Woods AE, Logan JM, Harrison RA, Castoe TA, de Koning AP, Pollock DD, Yandell M, Calderon D, Renjifo C, Currier RB, Salgado D, Pl Proc Natl Acad Sci U S A. 110:20651-20656(2013).