Stem-loop sequence oha-mir-34a

AccessionMI0031460 (change log)
DescriptionOphiophagus hannah miR-34a stem-loop
Gene family MIPF0000039; mir-34
Stem-loop
   --c   --      - gu    uu        -   a          --ggau  g 
5'    guu  ugugca u  uucu  ggcagugu cuu gcugguuguu      gu a
      |||  |||||| |  ||||  |||||||| ||| ||||||||||      ||  
3'    cgg  acacgu g  aaga  ucgucaua gaa cgacuaacga      cg u
   gaa   uu      c ug    cu        c   -          agaagu  g 
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (OphHan1.0; GCA_000516915.1) Overlapping transcripts
AZIM01008802.1: 1748-1852 [-]
intergenic
Database links

Mature sequence oha-miR-34a-5p

Accession MIMAT0036907
Sequence

19 - 

uggcagugucuuagcugguuguu

 - 41

Get sequence
Evidence not experimental

Mature sequence oha-miR-34a-3p

Accession MIMAT0036908
Sequence

62 - 

caaucagcaagcauacugc

 - 80

Get sequence
Evidence not experimental

References

1
PMID:24297900 "The king cobra genome reveals dynamic gene evolution and adaptation in the snake venom system" Vonk FJ, Casewell NR, Henkel CV, Heimberg AM, Jansen HJ, McCleary RJ, Kerkkamp HM, Vos RA, Guerreiro I, Calvete JJ, Wuster W, Woods AE, Logan JM, Harrison RA, Castoe TA, de Koning AP, Pollock DD, Yandell M, Calderon D, Renjifo C, Currier RB, Salgado D, Pl Proc Natl Acad Sci U S A. 110:20651-20656(2013).