Stem-loop sequence oha-mir-338

AccessionMI0031458 (change log)
DescriptionOphiophagus hannah miR-338 stem-loop
Gene family MIPF0000097; mir-338
Stem-loop
   ---  --g       u   -         -   ----   u 
5'    cc   ucaacaa auc cuggugcug agu    gag g
      ||   ||||||| ||| ||||||||| |||    ||| g
3'    gg   aguuguu uag gacuacgac uca    cuc c
   ggg  aga       u   u         c   gagg   a 
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (OphHan1.0; GCA_000516915.1) Overlapping transcripts
AZIM01000013.1: 479336-479409 [-]
intergenic
Database links

Mature sequence oha-miR-338-5p

Accession MIMAT0036903
Sequence

4 - 

ucaacaauauccuggugcuga

 - 24

Get sequence
Evidence not experimental

Mature sequence oha-miR-338-3p

Accession MIMAT0036904
Sequence

44 - 

uccagcaucagugauuuuguuga

 - 66

Get sequence
Evidence not experimental

References

1
PMID:24297900 "The king cobra genome reveals dynamic gene evolution and adaptation in the snake venom system" Vonk FJ, Casewell NR, Henkel CV, Heimberg AM, Jansen HJ, McCleary RJ, Kerkkamp HM, Vos RA, Guerreiro I, Calvete JJ, Wuster W, Woods AE, Logan JM, Harrison RA, Castoe TA, de Koning AP, Pollock DD, Yandell M, Calderon D, Renjifo C, Currier RB, Salgado D, Pl Proc Natl Acad Sci U S A. 110:20651-20656(2013).