Stem-loop sequence oha-mir-31

AccessionMI0031455 (change log)
DescriptionOphiophagus hannah miR-31 stem-loop
Gene family MIPF0000064; mir-31
Stem-loop
   agcag     ga     g    u        ugaugaa 
5'      gagag  ggcaa augu ggcauagc       c
        |||||  ||||| |||| ||||||||       g
3'      cuuuc  ccguu uaca ccguaucg       g
   cucca     uc     a    u        uccaaga 
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (OphHan1.0; GCA_000516915.1) Overlapping transcripts
AZIM01002885.1: 21934-22012 [-]
intergenic
Database links

Mature sequence oha-miR-31-5p

Accession MIMAT0036897
Sequence

10 - 

ggaggcaagauguuggcauagcug

 - 33

Get sequence
Evidence not experimental

Mature sequence oha-miR-31-3p

Accession MIMAT0036898
Sequence

48 - 

ugcuaugccuacauauugcccuc

 - 70

Get sequence
Evidence not experimental

References

1
PMID:24297900 "The king cobra genome reveals dynamic gene evolution and adaptation in the snake venom system" Vonk FJ, Casewell NR, Henkel CV, Heimberg AM, Jansen HJ, McCleary RJ, Kerkkamp HM, Vos RA, Guerreiro I, Calvete JJ, Wuster W, Woods AE, Logan JM, Harrison RA, Castoe TA, de Koning AP, Pollock DD, Yandell M, Calderon D, Renjifo C, Currier RB, Salgado D, Pl Proc Natl Acad Sci U S A. 110:20651-20656(2013).