Stem-loop sequence oha-mir-210

AccessionMI0031412 (change log)
DescriptionOphiophagus hannah miR-210 stem-loop
Gene family MIPF0000086; mir-210
Stem-loop
   caga       g    a   acua       u  --u  ug 
5'     agcaggu agcc cug    acgcaca ug   gc  c
       ||||||| |||| |||    ||||||| ||   ||   
3'     ucgucca ucgg gac    ugcgugu ac   ug  u
   ----       a    c   agug       c  ccc  ua 
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (OphHan1.0; GCA_000516915.1) Overlapping transcripts
AZIM01000089.1: 101059-101136 [+]
intergenic
Database links

Mature sequence oha-miR-210-5p

Accession MIMAT0036826
Sequence

13 - 

agccacugacuaacgcacau

 - 32

Get sequence
Evidence not experimental

Mature sequence oha-miR-210-3p

Accession MIMAT0036827
Sequence

51 - 

cugugcgugugacagcggcuaa

 - 72

Get sequence
Evidence not experimental

References

1
PMID:24297900 "The king cobra genome reveals dynamic gene evolution and adaptation in the snake venom system" Vonk FJ, Casewell NR, Henkel CV, Heimberg AM, Jansen HJ, McCleary RJ, Kerkkamp HM, Vos RA, Guerreiro I, Calvete JJ, Wuster W, Woods AE, Logan JM, Harrison RA, Castoe TA, de Koning AP, Pollock DD, Yandell M, Calderon D, Renjifo C, Currier RB, Salgado D, Pl Proc Natl Acad Sci U S A. 110:20651-20656(2013).