Stem-loop sequence oha-mir-199b

AccessionMI0031393 (change log)
DescriptionOphiophagus hannah miR-199b stem-loop
Gene family MIPF0000040; mir-199
Stem-loop
   --  ug    cac   cc   c  u        c   ucagaaa   a 
5'   uu  gccc   uug  cag gu cagacuac ugu       acu c
     ||  ||||   |||  ||| || |||||||| |||       ||| a
3'   ag  cggg   gau  guu ca guuugaug aca       uga a
   au  gu    uua   ua   a  c        -   -----ua   a 
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (OphHan1.0; GCA_000516915.1) Overlapping transcripts
AZIM01003798.1: 142031-142121 [-]
intergenic
Database links

Mature sequence oha-miR-199b-5p

Accession MIMAT0036791
Sequence

15 - 

cccagcguucagacuaccuguuc

 - 37

Get sequence
Evidence not experimental

Mature sequence oha-miR-199b-3p

Accession MIMAT0036792
Sequence

56 - 

acaguaguuugcacauugauua

 - 77

Get sequence
Evidence not experimental

References

1
PMID:24297900 "The king cobra genome reveals dynamic gene evolution and adaptation in the snake venom system" Vonk FJ, Casewell NR, Henkel CV, Heimberg AM, Jansen HJ, McCleary RJ, Kerkkamp HM, Vos RA, Guerreiro I, Calvete JJ, Wuster W, Woods AE, Logan JM, Harrison RA, Castoe TA, de Koning AP, Pollock DD, Yandell M, Calderon D, Renjifo C, Currier RB, Salgado D, Pl Proc Natl Acad Sci U S A. 110:20651-20656(2013).