Stem-loop sequence oha-mir-18b

AccessionMI0031382 (change log)
DescriptionOphiophagus hannah miR-18b stem-loop
Gene family MIPF0000001; mir-17
Stem-loop
   uuccu       --   u   uc   u     -uag  gacu 
5'      ugugcua  agg gca  uag gcagu    ug    a
        |||||||  ||| |||  ||| |||||    ||     
3'      acacggu  ucc cgu  guc cguca    ac    a
   ---gc       cu   u   ga   c     ucua  auuc 
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (OphHan1.0; GCA_000516915.1) Overlapping transcripts
AZIM01002644.1: 177020-177099 [+]
intergenic
Clustered miRNAs
< 10kb from oha-mir-18b
oha-mir-18bAZIM01002644.1: 177020-177099 [+]
oha-mir-20bAZIM01002644.1: 179551-179635 [+]
oha-mir-92a-2AZIM01002644.1: 179818-179909 [+]
oha-mir-363AZIM01002644.1: 179985-180068 [+]
Database links

Mature sequence oha-miR-18b-5p

Accession MIMAT0036770
Sequence

11 - 

uaaggugcaucuagugcaguuag

 - 33

Get sequence
Evidence not experimental

Mature sequence oha-miR-18b-3p

Accession MIMAT0036771
Sequence

52 - 

acugcccugagugcuccuucug

 - 73

Get sequence
Evidence not experimental

References

1
PMID:24297900 "The king cobra genome reveals dynamic gene evolution and adaptation in the snake venom system" Vonk FJ, Casewell NR, Henkel CV, Heimberg AM, Jansen HJ, McCleary RJ, Kerkkamp HM, Vos RA, Guerreiro I, Calvete JJ, Wuster W, Woods AE, Logan JM, Harrison RA, Castoe TA, de Koning AP, Pollock DD, Yandell M, Calderon D, Renjifo C, Currier RB, Salgado D, Pl Proc Natl Acad Sci U S A. 110:20651-20656(2013).