Stem-loop sequence oha-mir-181c

AccessionMI0031377 (change log)
DescriptionOphiophagus hannah miR-181c stem-loop
Gene family MIPF0000007; mir-181
Stem-loop
   aaaacuaaaa       aucaa        cu           --g    g 
5'           agucaca     cauucauu  gucgguggguu   uuau c
             |||||||     ||||||||  |||||||||||   ||||  
3'           ucggugu     guaaguga  uagucacucga   ggug u
   -------aag       -caac        -c           aga    g 
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (OphHan1.0; GCA_000516915.1) Overlapping transcripts
AZIM01000021.1: 758696-758788 [+]
intergenic
Clustered miRNAs
< 10kb from oha-mir-181c
oha-mir-181a-2AZIM01000021.1: 758346-758431 [+]
oha-mir-181cAZIM01000021.1: 758696-758788 [+]
Database links

Mature sequence oha-miR-181c-5p

Accession MIMAT0036760
Sequence

21 - 

aacauucauucugucgguggguu

 - 43

Get sequence
Evidence not experimental

Mature sequence oha-miR-181c-3p

Accession MIMAT0036761
Sequence

62 - 

cucacugaucagugaaugcaa

 - 82

Get sequence
Evidence not experimental

References

1
PMID:24297900 "The king cobra genome reveals dynamic gene evolution and adaptation in the snake venom system" Vonk FJ, Casewell NR, Henkel CV, Heimberg AM, Jansen HJ, McCleary RJ, Kerkkamp HM, Vos RA, Guerreiro I, Calvete JJ, Wuster W, Woods AE, Logan JM, Harrison RA, Castoe TA, de Koning AP, Pollock DD, Yandell M, Calderon D, Renjifo C, Currier RB, Salgado D, Pl Proc Natl Acad Sci U S A. 110:20651-20656(2013).