Stem-loop sequence oha-mir-17

AccessionMI0031372 (change log)
DescriptionOphiophagus hannah miR-17 stem-loop
Gene family MIPF0000001; mir-17
Stem-loop
   uca      a       -ca        a  g     g   u a  u 
5'    uguuag auaaugu   aagugcuu ca ugcag uag g uu a
      |||||| |||||||   |||||||| || ||||| ||| | ||  
3'    acgguc uauuacg   uucacgga gu acguc auc c ag u
   -ga      g       aug        a  g     -   - a  a 
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (OphHan1.0; GCA_000516915.1) Overlapping transcripts
AZIM01002132.1: 158388-158479 [-]
intergenic
Clustered miRNAs
< 10kb from oha-mir-17
oha-mir-17AZIM01002132.1: 158388-158479 [-]
oha-mir-18aAZIM01002132.1: 158255-158334 [-]
oha-mir-19aAZIM01002132.1: 158114-158203 [-]
oha-mir-20aAZIM01002132.1: 157971-158048 [-]
oha-mir-19bAZIM01002132.1: 157823-157918 [-]
oha-mir-92a-1AZIM01002132.1: 157713-157800 [-]
Database links

Mature sequence oha-miR-17-5p

Accession MIMAT0036751
Sequence

18 - 

caaagugcuuacagugcagguagu

 - 41

Get sequence
Evidence not experimental

Mature sequence oha-miR-17-3p

Accession MIMAT0036752
Sequence

56 - 

acugcagugaaggcacuuguag

 - 77

Get sequence
Evidence not experimental

References

1
PMID:24297900 "The king cobra genome reveals dynamic gene evolution and adaptation in the snake venom system" Vonk FJ, Casewell NR, Henkel CV, Heimberg AM, Jansen HJ, McCleary RJ, Kerkkamp HM, Vos RA, Guerreiro I, Calvete JJ, Wuster W, Woods AE, Logan JM, Harrison RA, Castoe TA, de Koning AP, Pollock DD, Yandell M, Calderon D, Renjifo C, Currier RB, Salgado D, Pl Proc Natl Acad Sci U S A. 110:20651-20656(2013).