Stem-loop sequence oha-mir-16b

AccessionMI0031369 (change log)
DescriptionOphiophagus hannah miR-16b stem-loop
Gene family MIPF0000006; mir-15
Stem-loop
   -a     uc    gu         ua           a  a 
5'   cuugu  cgcu  agcagcacg  aauauuggugu gu a
     |||||  ||||  |||||||||  ||||||||||| ||  
3'   ggaca  guga  ucgucgugu  uuauaaccgca ua a
   ag     gu    au         ua           a  g 
Get sequence
Confidence
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (OphHan1.0; GCA_000516915.1) Overlapping transcripts
AZIM01000178.1: 249110-249192 [-]
intergenic
Clustered miRNAs
< 10kb from oha-mir-16b
oha-mir-15aAZIM01000178.1: 249265-249363 [-]
oha-mir-16bAZIM01000178.1: 249110-249192 [-]
Database links

Mature sequence oha-miR-16b-5p

Accession MIMAT0036746
Sequence

14 - 

uagcagcacguaaauauuggug

 - 35

Get sequence
Evidence not experimental

Mature sequence oha-miR-16b-3p

Accession MIMAT0036747
Sequence

50 - 

ccaauauuauugugcugcuu

 - 69

Get sequence
Evidence not experimental

References

1
PMID:24297900 "The king cobra genome reveals dynamic gene evolution and adaptation in the snake venom system" Vonk FJ, Casewell NR, Henkel CV, Heimberg AM, Jansen HJ, McCleary RJ, Kerkkamp HM, Vos RA, Guerreiro I, Calvete JJ, Wuster W, Woods AE, Logan JM, Harrison RA, Castoe TA, de Koning AP, Pollock DD, Yandell M, Calderon D, Renjifo C, Currier RB, Salgado D, Pl Proc Natl Acad Sci U S A. 110:20651-20656(2013).