Stem-loop sequence oha-mir-16a

AccessionMI0031368 (change log)
DescriptionOphiophagus hannah miR-16a stem-loop
Gene family MIPF0000006; mir-15
Stem-loop
   ----    ug   c           -uaa         uuau    a 
5'     cagu  ugc uuagcagcaua    auauuggag    cauu g
       ||||  ||| |||||||||||    |||||||||    |||| u
3'     gucg  aug aaucgucgugu    uaugaccuc    guga a
   ucuu    ga   a           ugac         ---u    a 
Get sequence
Confidence Annotation confidence: undefined
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (OphHan1.0; GCA_000516915.1) Overlapping transcripts
AZIM01002914.1: 113190-113278 [+]
intergenic
Database links

Mature sequence oha-miR-16a-5p

Accession MIMAT0036744
Sequence

12 - 

uagcagcauauaaauauuggag

 - 33

Get sequence
Evidence not experimental

Mature sequence oha-miR-16a-3p

Accession MIMAT0036745
Sequence

54 - 

ccaguaucaguugugcugcuaa

 - 75

Get sequence
Evidence not experimental

References

1
PMID:24297900 "The king cobra genome reveals dynamic gene evolution and adaptation in the snake venom system" Vonk FJ, Casewell NR, Henkel CV, Heimberg AM, Jansen HJ, McCleary RJ, Kerkkamp HM, Vos RA, Guerreiro I, Calvete JJ, Wuster W, Woods AE, Logan JM, Harrison RA, Castoe TA, de Koning AP, Pollock DD, Yandell M, Calderon D, Renjifo C, Currier RB, Salgado D, Pl Proc Natl Acad Sci U S A. 110:20651-20656(2013).