Stem-loop sequence oha-mir-15b

AccessionMI0031367 (change log)
DescriptionOphiophagus hannah miR-15b stem-loop
Gene family MIPF0000006; mir-15
Stem-loop
   caaccuu     g c ua     a  ac          gagaa 
5'        gaggu a g  gcagc cg  augguuugua     a
          ||||| | |  ||||| ||  ||||||||||      
3'        cucca u c  cgucg gu  ugccagacau     a
   -------     g a uc     g  cu          agaag 
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (OphHan1.0; GCA_000516915.1) Overlapping transcripts
AZIM01002644.1: 127834-127914 [+]
intergenic
Database links

Mature sequence oha-miR-15b-5p

Accession MIMAT0036742
Sequence

17 - 

uagcagcacgacaugguuugua

 - 38

Get sequence
Evidence not experimental

Mature sequence oha-miR-15b-3p

Accession MIMAT0036743
Sequence

53 - 

cagaccguucugggcugccuca

 - 74

Get sequence
Evidence not experimental

References

1
PMID:24297900 "The king cobra genome reveals dynamic gene evolution and adaptation in the snake venom system" Vonk FJ, Casewell NR, Henkel CV, Heimberg AM, Jansen HJ, McCleary RJ, Kerkkamp HM, Vos RA, Guerreiro I, Calvete JJ, Wuster W, Woods AE, Logan JM, Harrison RA, Castoe TA, de Koning AP, Pollock DD, Yandell M, Calderon D, Renjifo C, Currier RB, Salgado D, Pl Proc Natl Acad Sci U S A. 110:20651-20656(2013).