Stem-loop sequence oha-mir-15a

AccessionMI0031366 (change log)
DescriptionOphiophagus hannah miR-15a stem-loop
Gene family MIPF0000006; mir-15
Stem-loop
   ---   ggaag   c     a   u       c  c           uucau 
5'    ucu     ccu agagu cua agcagca au augauuugugu     a
      |||     ||| ||||| ||| ||||||| || |||||||||||      
3'    aga     gga uuuua gau ucgucgu ua uacugaacgua     a
   aaa   ----a   a     a   u       u  u           uaaau 
Get sequence
Confidence Annotation confidence: undefined
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (OphHan1.0; GCA_000516915.1) Overlapping transcripts
AZIM01000178.1: 249265-249363 [-]
intergenic
Clustered miRNAs
< 10kb from oha-mir-15a
oha-mir-15aAZIM01000178.1: 249265-249363 [-]
oha-mir-16bAZIM01000178.1: 249110-249192 [-]
Database links

Mature sequence oha-miR-15a-5p

Accession MIMAT0036740
Sequence

22 - 

uagcagcacaucaugauuugu

 - 42

Get sequence
Evidence not experimental

Mature sequence oha-miR-15a-3p

Accession MIMAT0036741
Sequence

60 - 

caagucauuauuugcugcuuu

 - 80

Get sequence
Evidence not experimental

References

1
PMID:24297900 "The king cobra genome reveals dynamic gene evolution and adaptation in the snake venom system" Vonk FJ, Casewell NR, Henkel CV, Heimberg AM, Jansen HJ, McCleary RJ, Kerkkamp HM, Vos RA, Guerreiro I, Calvete JJ, Wuster W, Woods AE, Logan JM, Harrison RA, Castoe TA, de Koning AP, Pollock DD, Yandell M, Calderon D, Renjifo C, Currier RB, Salgado D, Pl Proc Natl Acad Sci U S A. 110:20651-20656(2013).