Stem-loop sequence oha-mir-146b

AccessionMI0031359 (change log)
DescriptionOphiophagus hannah miR-146b stem-loop
Gene family MIPF0000103; mir-146
Stem-loop
   ------------uaca      g       cug          u    -a   -   aga g 
5'                 uggcug cuuagcu   agaacugaau ccau  ggc uuu   a a
                   |||||| |||||||   |||||||||| ||||  ||| |||   |  
3'                 aucgac ggaucga   ucuugacuua ggug  ccg aaa   u a
   cgagagaccucaaaua      -       -ca          -    cc   c   --g a 
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (OphHan1.0; GCA_000516915.1) Overlapping transcripts
AZIM01000124.1: 99472-99578 [-]
intergenic
Database links

Mature sequence oha-miR-146b-5p

Accession MIMAT0036729
Sequence

20 - 

ugagaacugaauuccauaggcuuu

 - 43

Get sequence
Evidence not experimental

Mature sequence oha-miR-146b-3p

Accession MIMAT0036730
Sequence

58 - 

gccccguggauucaguucuac

 - 78

Get sequence
Evidence not experimental

References

1
PMID:24297900 "The king cobra genome reveals dynamic gene evolution and adaptation in the snake venom system" Vonk FJ, Casewell NR, Henkel CV, Heimberg AM, Jansen HJ, McCleary RJ, Kerkkamp HM, Vos RA, Guerreiro I, Calvete JJ, Wuster W, Woods AE, Logan JM, Harrison RA, Castoe TA, de Koning AP, Pollock DD, Yandell M, Calderon D, Renjifo C, Currier RB, Salgado D, Pl Proc Natl Acad Sci U S A. 110:20651-20656(2013).