Stem-loop sequence oha-mir-122

AccessionMI0031322 (change log)
DescriptionOphiophagus hannah miR-122 stem-loop
Gene family MIPF0000095; mir-122
Stem-loop
   gcu  -    uugg       c           u  uc 
5'    gg agcu    aguguga aaugguguuug au  a
      || ||||    ||||||| ||||||||||| ||  a
3'    uc ucga    ucacacu uuaccgcaaac ug  g
   --g  a    uaaa       a           -  uc 
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (OphHan1.0; GCA_000516915.1) Overlapping transcripts
AZIM01005362.1: 15232-15306 [+]
intergenic
Database links

Mature sequence oha-miR-122-5p

Accession MIMAT0036666
Sequence

11 - 

uggagugugacaaugguguuuguau

 - 35

Get sequence
Evidence not experimental

Mature sequence oha-miR-122-3p

Accession MIMAT0036667
Sequence

45 - 

caaacgccauuaucacacu

 - 63

Get sequence
Evidence not experimental

References

1
PMID:24297900 "The king cobra genome reveals dynamic gene evolution and adaptation in the snake venom system" Vonk FJ, Casewell NR, Henkel CV, Heimberg AM, Jansen HJ, McCleary RJ, Kerkkamp HM, Vos RA, Guerreiro I, Calvete JJ, Wuster W, Woods AE, Logan JM, Harrison RA, Castoe TA, de Koning AP, Pollock DD, Yandell M, Calderon D, Renjifo C, Currier RB, Salgado D, Pl Proc Natl Acad Sci U S A. 110:20651-20656(2013).