Stem-loop sequence oha-mir-101a

AccessionMI0031314 (change log)
DescriptionOphiophagus hannah miR-101a stem-loop
Gene family MIPF0000046; mir-101
Stem-loop
   cag      cuggc           u      a    gucua 
5'    gcugcc     ucaguuaucac gugcug ugcu     u
      ||||||     ||||||||||| |||||| ||||      
3'    cgaugg     agucaauagug caugac augg     a
   ---      uagga           u      -    aaauc 
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (OphHan1.0; GCA_000516915.1) Overlapping transcripts
AZIM01000560.1: 292653-292734 [+]
intergenic
Database links

Mature sequence oha-miR-101a-5p

Accession MIMAT0036650
Sequence

16 - 

caguuaucacugugcugaugcu

 - 37

Get sequence
Evidence not experimental

Mature sequence oha-miR-101a-3p

Accession MIMAT0036651
Sequence

51 - 

guacaguacugugauaacugaa

 - 72

Get sequence
Evidence not experimental

References

1
PMID:24297900 "The king cobra genome reveals dynamic gene evolution and adaptation in the snake venom system" Vonk FJ, Casewell NR, Henkel CV, Heimberg AM, Jansen HJ, McCleary RJ, Kerkkamp HM, Vos RA, Guerreiro I, Calvete JJ, Wuster W, Woods AE, Logan JM, Harrison RA, Castoe TA, de Koning AP, Pollock DD, Yandell M, Calderon D, Renjifo C, Currier RB, Salgado D, Pl Proc Natl Acad Sci U S A. 110:20651-20656(2013).