Stem-loop sequence tch-mir-194

AccessionMI0031298 (change log)
DescriptionTupaia chinensis miR-194 stem-loop
Gene family MIPF0000055; mir-194
Stem-loop
   --u         a      g     g gu 
5'    guaacagca cuccau uggaa u  c
      ||||||||| |||||| ||||| |  u
3'    uauugucgu ggggug accuu g  g
   guc         c      -     g uc 
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (TupChi_1.0; GCA_000334495.1) Overlapping transcripts
KB320702.1: 1746894-1746951 [-]
intergenic
Clustered miRNAs
< 10kb from tch-mir-194
tch-mir-194KB320702.1: 1746894-1746951 [-]
tch-mir-192KB320702.1: 1746694-1746759 [-]
Database links

Mature sequence tch-miR-194-5p

Accession MIMAT0036624
Sequence

1 - 

uguaacagcaacuccauguggaa

 - 23

Get sequence
Evidence experimental; Illumina [1]

References

1