Stem-loop sequence tch-mir-455

AccessionMI0031277 (change log)
DescriptionTupaia chinensis miR-455 stem-loop
Gene family MIPF0000129; mir-455
Stem-loop
   ----         u      a   c   gga 
5'     uaugugccu uggacu cau gug   g
       ||||||||| |||||| ||| |||    
3'     auauacggg accuga gua cac   c
   ucac         u      c   c   gac 
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (TupChi_1.0; GCA_000334495.1) Overlapping transcripts
KB320489.1: 5301569-5301628 [+]
intergenic
Database links

Mature sequence tch-miR-455-3p

Accession MIMAT0036608
Sequence

39 - 

gcaguccaugggcauauacacu

 - 60

Get sequence
Evidence experimental; Illumina [1]

References

1