Stem-loop sequence tch-mir-135a

AccessionMI0031261 (change log)
DescriptionTupaia chinensis miR-135a stem-loop
Gene family MIPF0000028; mir-135
Stem-loop
   --         uu            uucua 
5'   uauggcuuu  auuccuauguga     c
     |||||||||  ||||||||||||     u
3'   gugccgagg  uagggauauacu     g
   cg         -u            cacuc 
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (TupChi_1.0; GCA_000334495.1) Overlapping transcripts
KB367803.1: 1444030-1444089 [+]
intergenic
Database links

Mature sequence tch-miR-135a-5p

Accession MIMAT0036595
Sequence

1 - 

uauggcuuuuuauuccuauguga

 - 23

Get sequence
Evidence experimental; Illumina [1]

References

1