Stem-loop sequence tch-mir-9-3

AccessionMI0031250 (change log)
DescriptionTupaia chinensis miR-9-3 stem-loop
Gene family MIPF0000014; mir-9
Stem-loop
   -uc               g      u  ug 
5'    uuugguuaucuagcu uaugag gg  u
      ||||||||||||||| |||||| ||  g
3'    aagccaauagaucga auacuu cu  g
   uga               a      -  ga 
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (TupChi_1.0; GCA_000334495.1) Overlapping transcripts
KB320890.1: 825879-825939 [-]
intergenic
Database links

Mature sequence tch-miR-9-5p

Accession MIMAT0036524
Sequence

1 - 

ucuuugguuaucuagcuguauga

 - 23

Get sequence
Evidence experimental; Illumina [1]

References

1