Stem-loop sequence tch-mir-671

AccessionMI0031243 (change log)
DescriptionTupaia chinensis miR-671 stem-loop
Gene family MIPF0000358; mir-671
Stem-loop
   --a   a      ga           -u   g 
5'    gga gcccug  ggggcuggagg  gau g
      ||| ||||||  |||||||||||  |||  
3'    ccu cgggac  ucuuggccucc  uug a
   cca   -      --           uu   u 
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (TupChi_1.0; GCA_000334495.1) Overlapping transcripts
KB320710.1: 593893-593952 [+]
intergenic
Database links

Mature sequence tch-miR-671-5p

Accession MIMAT0036579
Sequence

1 - 

aggaagcccuggaggggcuggagg

 - 24

Get sequence
Evidence experimental; Illumina [1]

References

1