Stem-loop sequence tch-mir-34c

AccessionMI0031239 (change log)
DescriptionTupaia chinensis miR-34c stem-loop
Gene family MIPF0000039; mir-34
Stem-loop
   --a   a    a     c      c  a 
5'    ggc gugu guuag ugauug ua u
      ||| |||| ||||| |||||| ||  
3'    ccg caca caauc acuaac au a
   gga   g    c     -      c  g 
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (TupChi_1.0; GCA_000334495.1) Overlapping transcripts
KB320750.1: 6083291-6083345 [+]
intergenic
Database links

Mature sequence tch-miR-34c-5p

Accession MIMAT0036575
Sequence

1 - 

aggcaguguaguuagcugauugc

 - 23

Get sequence
Evidence experimental; Illumina [1]

References

1